BIOINFORMATICS- AN INTRODUCTION

Hai guys,
In this post , i am going to write some basic introduction regarding bioinformatics.
The first step of the human genome sequencing project has involved identifying those DNA sequences which code for proteins synthesised by the cell and hence which define its function. For this reason researchers have been isolating the mRNAs expressed in cells, converting them to DNA (cDNA), cloning them and sequencing them in their 1000s. These expressed sequences are given the name of EST (Expressed Sequence Tag). As the sequencing of the human genome progresses the function of more and more DNA/protein sequences are identified. Therefore, it is now routine to generate many ESTs and then to compare them with sequences in the databases to determine their function.

Let us take this EST which is given below:

1 gaacgacctctctcaggcttagcctgggctgtagctatgataaaccggcaggagattggt ggacctcgctcttataccatcgcagttgcttccctgggtaaaggagtggcctgtaatcct gcctgcttcatcacacagctcctccctgtgaaaaggaagctagggttctatgaatggact tcaaggttaagaagtcacataaatcccacaggcactgttttgcttcagctagaaaataca
This part of the practical illustrates how to compare DNA sequences against the DNA databanks using BLAST (Basic Local Alignment Search Tool) to find out what they code for.

1.Copy the relevant sequence onto the clipboard.
2.Click here to go to Sequence Search at NCBI (http://www.ncbi.nlm.nih.gov/BLAST):
3.An NCBI BLAST page will be returned .In that choose the option such as below:
4.Choose the ‘nucleotide blast’ option.
5.A page will be returned with a query window.
6.Paste the sequence into the window.
7.Under ‘Choose Search Set’ set to ‘Nucleotide collection (nr/nt)’.
8.Press the BLAST button and wait while the sequence is compared to the databases and the matches displayed.
9.A page is returned indicating that the ID request and that the search has been placed in a queuing system.
10.Carefully study the output.

INTERPRETATION OF BLAST RESULTS
1. A page will be returned with the results from BLAST search. These are presented both graphically and textually.

2. The graphical view shows the query sequence as a thick red line with base numbers attached to it. Below this are a series of coloured thin lines that represent matches to the query sequence. The length of the line indicates that part of the query sequence which matches the hit sequence. The colour represents the quality of the match.

3. The textual view is found below the picture. It is a list of files that correspond to the visual display matches and sorted in match quality order.
The first hyperlink is to the file containing the entire sequence. If you click on this hyperlink you can view the actual sequence file and information on the sequence it contains (e.g. what it codes for, organism source, repeat regions if any etc ,
4. To display a FASTA version of the file, in the drop down menu next to ‘Display’, click on FASTA and then click ‘Display’. The file for the same gene is now in FASTA format – a format that is used as an input for many different computer programs.
5. This is followed by a very brief description of the file. This description is taken from the sequence file.

6. The next number is a numerical score (Score - bits) which represents a statistical measure of how good the match was (the greater the score the better the match). This score is hyperlinked to the actual match found between your query sequence and the match itself.
Finally the Expect value (E) is a parameter that describes the number of hits one can "expect" to see just by chance when searching a database of a particular size. Essentially, it describes the random background noise that exists for matches between sequences

Exercise for practice
If you want to practice some query sequence,you can just try these sequences given below.
1.tgtgttttatgtcttctacgaacagtacctgaccatcattgacgacactatcttcaacct cggtgtgtccctgggcgcgatatttctggtgaccatggtcctcctgggctgtgagctctg gtctgcagtcatcatgtgtgccaccatcgccatggtcttggtcaacatgtttggagttat gtggctctggggcatcagtctgaacgctgtatccttggtcaacctggtgatg

2.tggtccctatgggcttccgcacatgccgcgggcggccaggcaacgtgcgtgtctctgcca tgtggcagaagtgctctttgtggcagtggccaggcagggagtgtctgcagtcctggtggg gctgagcctgaggccttccagaaagcaggagcagctgtgctgcaccccatgtgggtgacc aggtcctttctcctgatagtcacctgctggttgttgccaggttgcagctgctcttgcatc

3.cccaaatgaagtgtgaacgtgatgttttcggatgcaaactcagctcagggattcattttg tgtcttagttttatatgcatccttatttttaatacacctgcttcacgtccctatgttggg aagtccatatttgtctgcttttcttgcagcatcatttccttacaatactgtccggtggac aaaatgacaattgatatgtttttctgatataattactttagctgcactaacagtacaatg

BIOLUMININESCENCE

Bioluminescence is the production and emission of light by a living organism. Bioluminescence is a naturally occurring form of chemiluminescence where energy is released by a chemical reaction in the form of light emission. Fireflies, anglerfish, and other creatures produce the chemicals luciferin (a pigment) and luciferase (an enzyme). The luceferin reacts with oxygen to create light. The luciferase acts as a catalyst to speed up the reaction, which is sometimes mediated by cofactors such as calcium ions or ATP. The chemical reaction can occur either inside or outside the cell. In bacteria, the expression of genes related to bioluminescence is controlled by an operon called the Lux operon. Based on its diversity and phylogenetic distribution, it is estimated that bioluminescence has arisen independently as many as 30 times in the course of evolution

Bioluminescence in Biotechnology
Bioluminescent organisms are a target for many areas of research. Luciferase systems are widely used in the field of genetic engineering as reporter genes. Luciferase systems have also been harnessed for biomedical research using bioluminescence imaging.Vibrio symbiosis with numerous marine invertebrates and fish, namely the Hawaiian Bobtail Squid (Euprymna scolopes), are key experimental model for symbiosis, quorum sensing, and bioluminescence.The structure of photophores, the light producing organs in bioluminescent organisms, are being investigated by industrial designers.
All cells produce some form of bioluminescence within the electromagnetic spectrum, but most are neither visible nor noticeable to the naked eye. Every organism's bioluminescence is unique in wavelength, duration, timing and regularity of flashes.

Application
Glowing trees to line highways to save government electricity bills
Christmas trees that do not need lights, reducing danger from electrical fires
Agricultural crops and domestic plants that luminesce when they need watering New methods for detecting bacterial contamination of meats and other foods
Bio-identifiers for escaped convicts and mental patients

Detecting bacterial species in suspicious corpses

Novelty pets that bioluminesce (rabbits, mice, fish etc.)

example : every living organism on Pandora is bioluminescent.

An Introduction to stem cells

Stem cells have the remarkable potential to develop into many different cell types in the body during early life and growth. In addition, in many tissues they serve as a sort of internal repair system, dividing essentially without limit to replenish other cells as long as the person or animal is still alive. When a stem cell divides, each new cell has the potential either to remain a stem cell or become another type of cell with a more specialized function, such as a muscle cell, a red blood cell, or a brain cell.

Stem cells are distinguished from other cell types by two important characteristics. First, they are unspecialized cells capable of renewing themselves through cell division, sometimes after long periods of inactivity. Second, under certain physiologic or experimental conditions, they can be induced to become tissue- or organ-specific cells with special functions. In some organs, such as the gut and bone marrow, stem cells regularly divide to repair and replace worn out or damaged tissues. In other organs, however, such as the pancreas and the heart, stem cells only divide under special conditions.

Until recently, scientists primarily worked with two kinds of stem cells from animals and humans: embryonic stem cells and non-embryonic "somatic" or "adult" stem cells. The functions and characteristics of these cells will be explained in this document. Scientists discovered ways to derive embryonic stem cells from early mouse embryos nearly 30 years ago, in 1981. The detailed study of the biology of mouse stem cells led to the discovery, in 1998, of a method to derive stem cells from human embryos and grow the cells in the laboratory. These cells are called human embryonic stem cells. The embryos used in these studies were created for reproductive purposes through in vitrofertilization procedures. When they were no longer needed for that purpose, they were donated for research with the informed consent of the donor. In 2006, researchers made another breakthrough by identifying conditions that would allow some specialized adult cells to be "reprogrammed" genetically to assume a stem cell-like state. This new type of stem cell, called induced pluripotent stem cells (iPSCs), will be discussed in a later section of this document.

Stem cells are important for living organisms for many reasons. In the 3- to 5-day-old embryo, called a blastocyst, the inner cells give rise to the entire body of the organism, including all of the many specialized cell types and organs such as the heart, lung, skin, sperm, eggs and other tissues. In some adult tissues, such as bone marrow, muscle, and brain, discrete populations of adult stem cells generate replacements for cells that are lost through normal wear and tear, injury, or disease.

Given their unique regenerative abilities, stem cells offer new potentials for treating diseases such as diabetes, and heart disease. However, much work remains to be done in the laboratory and the clinic to understand how to use these cells for cell-based therapies to treat disease, which is also referred to as regenerative or reparative medicine.

Laboratory studies of stem cells enable scientists to learn about the cells’ essential properties and what makes them different from specialized cell types. Scientists are already using stem cells in the laboratory to screen new drugs and to develop model systems to study normal growth and identify the causes of birth defects.

Research on stem cells continues to advance knowledge about how an organism develops from a single cell and how healthy cells replace damaged cells in adult organisms. Stem cell research is one of the most fascinating areas of contemporary biology, but, as with many expanding fields of scientific inquiry, research on stem cells raises scientific questions as rapidly as it generates new discoveries.

Stem cells differ from other kinds of cells in the body. All stem cells—regardless of their source—have three general properties: they are capable of dividing and renewing themselves for long periods; they are unspecialized; and they can give rise to specialized cell types

An adult stem cell is thought to be an undifferentiated cell, found among differentiated cells in a tissue or organ that can renew itself and can differentiate to yield some or all of the major specialized cell types of the tissue or organ. The primary roles of adult stem cells in a living organism are to maintain and repair the tissue in which they are found. Scientists also use the term somatic stem cell instead of adult stem cell, where somatic refers to cells of the body (not the germ cells, sperm or eggs). Unlike embryonic stem cells, which are defined by their origin (the inner cell mass of the blastocyst), the origin of adult stem cells in some mature tissues is still under investigation.

Adult stem cells have been identified in many organs and tissues, including brain, bone marrow, peripheral blood, blood vessels, skeletal muscle, skin, teeth, heart, gut, liver, ovarian epithelium, and testis.

USES OF STEMCELLS

There are many ways in which human stem cells can be used in research and the clinic. Studies of human embryonic stem cells will yield information about the complex events that occur during human development. A primary goal of this work is to identify howundifferentiated stem cells become the differentiated cells that form the tissues and organs. Scientists know that turning genes on and off is central to this process. Some of the most serious medical conditions, such as cancer and birth defects, are due to abnormal cell division and differentiation. A more complete understanding of the genetic and molecular controls of these processes may yield information about how such diseases arise and suggest new strategies for therapy. Predictably controlling cell proliferation and differentiation requires additional basic research on the molecular and genetic signals that regulate cell division and specialization. While recent developments with iPS cells suggest some of the specific factors that may be involved, techniques must be devised to introduce these factors safely into the cells and control the processes that are induced by these factors.

Human stem cells could also be used to test new drugs. For example, new medications could be tested for safety on differentiated cells generated from human pluripotent cell lines. Other kinds of cell lines are already used in this way. Cancer cell lines, for example, are used to screen potential anti-tumor drugs. The availability of pluripotent stem cells would allow drug testing in a wider range of cell types. However, to screen drugs effectively, the conditions must be identical when comparing different drugs. Therefore, scientists will have to be able to precisely control the differentiation of stem cells into the specific cell type on which drugs will be tested. Current knowledge of the signals controlling differentiation falls short of being able to mimic these conditions precisely to generate pure populations of differentiated cells for each drug being tested.

Perhaps the most important potential application of human stem cells is the generation of cells and tissues that could be used for cell-based therapies. Today, donated organs and tissues are often used to replace ailing or destroyed tissue, but the need for transplantable tissues and organs far outweighs the available supply. Stem cells, directed to differentiate into specific cell types, offer the possibility of a renewable source of replacement cells and tissues to treat diseases including Alzheimer's diseases, spinal cord injury, stroke, burns, heart disease, diabetes, osteoarthritis, and rheumatoid arthritis.

For example, it may become possible to generate healthy heart muscle cells in the laboratory and then transplant those cells into patients with chronic heart disease. Preliminary research in mice and other animals indicates that bone marrow stromal cells, transplanted into a damaged heart, can have beneficial effects. Whether these cells can generate heart muscle cells or stimulate the growth of new blood vessels that repopulate the heart tissue, or help via some other mechanism is actively under investigation. For example, injected cells may accomplish repair by secreting growth factors, rather than actually incorporating into the heart. Promising results from animal studies have served as the basis for a small number of exploratory studies in humans (for discussion, see call-out box, "Can Stem Cells Mend a Broken Heart?"). Other recent studies in cell culturesystems indicate that it may be possible to direct the differentiation of embryonic stem cells or adult bone marrow cells into heart muscle cells.

Strategies to repair heart muscle with adult stem cells© 2001 Terese Winslow

COURTESY:

The National Institute of Health resource For stem cell research.

Stem Cells

GM food- A boon or ban

Genetically-modified foods (GM foods) have made a big splash in the news lately. European environmental organizations and public interest groups have been actively protesting against GM foods for months, and recent controversial studies about the effects of genetically-modified corn pollen on monarch butterfly caterpillars have brought the issue of genetic engineering to the forefront of the public consciousness in the U.S. In response to the upswelling of public concern, the U.S. Food and Drug Administration (FDA) held three open meetings in Chicago, Washington, D.C., and Oakland, California to solicit public opinions and begin the process of establishing a new regulatory procedure for government approval of GM foods.

Genetically modified foods

The term GM foods or GMOs (genetically-modified organisms) is most commonly used to refer to crop plants created for human or animal consumption using the latest molecular biology techniques. These plants have been modified in the laboratory to enhance desired traits such as increased resistance to herbicides or improved nutritional content. The enhancement of desired traits has traditionally been undertaken through breeding, but conventional plant breeding methods can be very time consuming and are often not very accurate. Genetic engineering, on the other hand, can create plants with the exact desired trait very rapidly and with great accuracy. For example, plant geneticists can isolate a gene responsible for drought tolerance and insert that gene into a different plant. The new genetically-modified plant will gain drought tolerance as well. Not only can genes be transferred from one plant to another, but genes from non-plant organisms also can be used. The best known example of this is the use of B.t. genes in corn and other crops. B.t., or Bacillus thuringiensis, is a naturally occurring bacterium that produces crystal proteins that are lethal to insect larvae. B.t. crystal protein genes have been transferred into corn, enabling the corn to produce its own pesticides against insects such as the European corn borer. For two informative overviews of some of the techniques involved in creating GM foods, visit Biotech Basics (sponsored by Monsanto)

Refer http://www.biotechknowledge.monsanto.com/biotech/bbasics.nsf/index

or

Techniques of Plant Biotechnology from the National Center for Biotechnology Educationhttp://www.ncbe.reading.ac.uk/NCBE/GMFOOD/techniques.

ADVANTAGES

The world population has topped 6 billion people and is predicted to double in the next 50 years. Ensuring an adequate food supply for this booming population is going to be a major challenge in the years to come. GM foods promise to meet this need in a number of ways:

Pest resistance Crop losses from insect pests can be staggering, resulting in devastating financial loss for farmers and starvation in developing countries. Farmers typically use many tons of chemical pesticides annually. Consumers do not wish to eat food that has been treated with pesticides because of potential health hazards, and run-off of agricultural wastes from excessive use of pesticides and fertilizers can poison the water supply and cause harm to the environment. Growing GM foods such as B.t. corn can help eliminate the application of chemical pesticides and reduce the cost of bringing a crop to market.

Herbicide tolerance For some crops, it is not cost-effective to remove weeds by physical means such as tilling, so farmers will often spray large quantities of different herbicides (weed-killer) to destroy weeds, a time-consuming and expensive process, that requires care so that the herbicide doesn't harm the crop plant or the environment. Crop plants genetically-engineered to be resistant to one very powerful herbicide could help prevent environmental damage by reducing the amount of herbicides needed. For example, Monsanto has created a strain of soybeans genetically modified to be not affected by their herbicide product Roundup ®. A farmer grows these soybeans which then only require one application of weed-killer instead of multiple applications, reducing production cost and limiting the dangers of agricultural waste run-ofF.

Disease resistance There are many viruses, fungi and bacteria that cause plant diseases. Plant biologists are working to create plants with genetically-engineered resistance to these diseases.

Cold tolerance Unexpected frost can destroy sensitive seedlings. An antifreeze gene from cold water fish has been introduced into plants such as tobacco and potato. With this antifreeze gene, these plants are able to tolerate cold temperatures that normally would kill unmodified seedlings. (not yet patented).

Drought tolerance/salinity tolerance As the world population grows and more land is utilized for housing instead of food production, farmers will need to grow crops in locations previously unsuited for plant cultivation. Creating plants that can withstand long periods of drought or high salt content in soil and groundwater will help people to grow crops in formerly inhospitable places.

Nutrition Malnutrition is common in third world countries where impoverished peoples rely on a single crop such as rice for the main staple of their diet. However, rice does not contain adequate amounts of all necessary nutrients to prevent malnutrition. If rice could be genetically engineered to contain additional vitamins and minerals, nutrient deficiencies could be alleviated. For example, blindness due to vitamin A deficiency is a common problem in third world countries. Researchers at the Swiss Federal Institute of Technology Institute for Plant Sciences have created a strain of "golden" rice containing an unusually high content of beta-carotene (vitamin A). Since this rice was funded by the Rockefeller Foundation, a non-profit organization, the Institute hopes to offer the golden rice seed free to any third world country that requests it. Plans were underway to develop a golden rice that also has increased iron content. However, the grant that funded the creation of these two rice strains was not renewed, perhaps because of the vigorous anti-GM food protesting in Europe, and so this nutritionally-enhanced rice may not come to market at all.

Pharmaceuticals Medicines and vaccines often are costly to produce and sometimes require special storage conditions not readily available in third world countries. Researchers are working to develop edible vaccines in tomatoes and potatoes. These vaccines will be much easier to ship, store and administer than traditional injectable vaccines.

Phytoremediation Not all GM plants are grown as crops. Soil and groundwater pollution continues to be a problem in all parts of the world. Plants such as poplar trees have been genetically engineered to clean up heavy metal pollution from contaminated soil.

Environmental activists, religious organizations, public interest groups, professional associations and other scientists and government officials have all raised concerns about GM foods, and criticized agribusiness for pursuing profit without concern for potential hazards, and the government for failing to exercise adequate regulatory oversight. It seems that everyone has a strong opinion about GM foods. Even the Vatican and the Prince of Wales have expressed their opinions. Most concerns about GM foods fall into three categories: environmental hazards, human health risks, and economic concerns.

Environmental hazards

Unintended harm to other organisms Last year a laboratory study was published inNature showing that pollen from B.t. corn caused high mortality rates in monarch butterfly caterpillars. Monarch caterpillars consume milkweed plants, not corn, but the fear is that if pollen from B.t. corn is blown by the wind onto milkweed plants in neighboring fields, the caterpillars could eat the pollen and perish. Although the Nature study was not conducted under natural field conditions, the results seemed to support this viewpoint. Unfortunately, B.t. toxins kill many species of insect larvae indiscriminately; it is not possible to design a B.t. toxin that would only kill crop-damaging pests and remain harmless to all other insects. This study is being reexamined by the USDA, the U.S. Environmental Protection Agency (EPA) and other non-government research groups, and preliminary data from new studies suggests that the original study may have been flawed. This topic is the subject of acrimonious debate, and both sides of the argument are defending their data vigorously. Currently, there is no agreement about the results of these studies, and the potential risk of harm to non-target organisms will need to be evaluated further.

Reduced effectiveness of pesticides Just as some populations of mosquitoes developed resistance to the now-banned pesticide DDT, many people are concerned that insects will become resistant to B.t. or other crops that have been genetically-modified to produce their own pesticides.

Gene transfer to non-target species Another concern is that crop plants engineered for herbicide tolerance and weeds will cross-breed, resulting in the transfer of the herbicide resistance genes from the crops into the weeds. These "superweeds" would then be herbicide tolerant as well. Other introduced genes may cross over into non-modified crops planted next to GM crops. The possibility of interbreeding is shown by the defense of farmers against lawsuits filed by Monsanto. The company has filed patent infringement lawsuits against farmers who may have harvested GM crops. Monsanto claims that the farmers obtained Monsanto-licensed GM seeds from an unknown source and did not pay royalties to Monsanto. The farmers claim that their unmodified crops were cross-pollinated from someone else's GM crops planted a field or two away. More investigation is needed to resolve this issue.

There are several possible solutions to the three problems mentioned above. Genes are exchanged between plants via pollen. Two ways to ensure that non-target species will not receive introduced genes from GM plants are to create GM plants that are male sterile (do not produce pollen) or to modify the GM plant so that the pollen does not contain the introduced gene. Cross-pollination would not occur, and if harmless insects such as monarch caterpillars were to eat pollen from GM plants, the caterpillars would survive.

Another possible solution is to create buffer zones around fields of GM crops. For example, non-GM corn would be planted to surround a field of B.t. GM corn, and the non-GM corn would not be harvested. Beneficial or harmless insects would have a refuge in the non-GM corn, and insect pests could be allowed to destroy the non-GM corn and would not develop resistance to B.t. pesticides. Gene transfer to weeds and other crops would not occur because the wind-blown pollen would not travel beyond the buffer zone. Estimates of the necessary width of buffer zones range from 6 meters to 30 meters or more. This planting method may not be feasible if too much acreage is required for the buffer zones.

Human health risks

Allergenicity Many children in the US and Europe have developed life-threatening allergies to peanuts and other foods. There is a possibility that introducing a gene into a plant may create a new allergen or cause an allergic reaction in susceptible individuals. A proposal to incorporate a gene from Brazil nuts into soybeans was abandoned because of the fear of causing unexpected allergic reactions. Extensive testing of GM foods may be required to avoid the possibility of harm to consumers with food allergies. Labeling of GM foods and food products will acquire new importance, which I shall discuss later.

Unknown effects on human health There is a growing concern that introducing foreign genes into food plants may have an unexpected and negative impact on human health. A recent article published in Lancet examined the effects of GM potatoes on the digestive tract in rats. This study claimed that there were appreciable differences in the intestines of rats fed GM potatoes and rats fed unmodified potatoes. Yet critics say that this paper, like the monarch butterfly data, is flawed and does not hold up to scientific scrutiny. Moreover, the gene introduced into the potatoes was a snowdrop flower lectin, a substance known to be toxic to mammals. The scientists who created this variety of potato chose to use the lectin gene simply to test the methodology, and these potatoes were never intended for human or animal consumption.

On the whole, with the exception of possible allergenicity, scientists believe that GM foods do not present a risk to human health.

Economic concerns

Bringing a GM food to market is a lengthy and costly process, and of course agri-biotech companies wish to ensure a profitable return on their investment. Many new plant genetic engineering technologies and GM plants have been patented, and patent infringement is a big concern of agribusiness. Yet consumer advocates are worried that patenting these new plant varieties will raise the price of seeds so high that small farmers and third world countries will not be able to afford seeds for GM crops, thus widening the gap between the wealthy and the poor. It is hoped that in a humanitarian gesture, more companies and non-profits will follow the lead of the Rockefeller Foundation and offer their products at reduced cost to impoverished nations.

Patent enforcement may also be difficult, as the contention of the farmers that they involuntarily grew Monsanto-engineered strains when their crops were cross-pollinated shows. One way to combat possible patent infringement is to introduce a "suicide gene" into GM plants. These plants would be viable for only one growing season and would produce sterile seeds that do not germinate. Farmers would need to buy a fresh supply of seeds each year. However, this would be financially disastrous for farmers in third world countries who cannot afford to buy seed each year and traditionally set aside a portion of their harvest to plant in the next growing season. In an open letter to the public, Monsanto has pledged to abandon all research using this suicide gene technology

LABELLING OF GM FOODS

Labeling of GM foods and food products is also a contentious issue. On the whole, agribusiness industries believe that labeling should be voluntary and influenced by the demands of the free market. If consumers show preference for labeled foods over non-labeled foods, then industry will have the incentive to regulate itself or risk alienating the customer. Consumer interest groups, on the other hand, are demanding mandatory labeling. People have the right to know what they are eating, argue the interest groups, and historically industry has proven itself to be unreliable at self-compliance with existing safety regulations. The FDA's current position on food labeling is governed by the Food, Drug and Cosmetic Act which is only concerned with food additives, not whole foods or food products that are considered "GRAS" - generally recognized as safe. The FDA contends that GM foods are substantially equivalent to non-GM foods, and therefore not subject to more stringent labeling. If all GM foods and food products are to be labeled, Congress must enact sweeping changes in the existing food labeling policy.

There are many questions that must be answered if labeling of GM foods becomes mandatory. First, are consumers willing to absorb the cost of such an initiative? If the food production industry is required to label GM foods, factories will need to construct two separate processing streams and monitor the production lines accordingly. Farmers must be able to keep GM crops and non-GM crops from mixing during planting, harvesting and shipping. It is almost assured that industry will pass along these additional costs to consumers in the form of higher prices.

Secondly, what are the acceptable limits of GM contamination in non-GM products? The EC has determined that 1% is an acceptable limit of cross-contamination, yet many consumer interest groups argue that only 0% is acceptable. Some companies such as Gerber baby foods and Frito-Lay have pledged to avoid use of GM foods in any of their products. But who is going to monitor these companies for compliance and what is the penalty if they fail? Once again, the FDA does not have the resources to carry out testing to ensure compliance.

What is the level of detectability of GM food cross-contamination? Scientists agree that current technology is unable to detect minute quantities of contamination, so ensuring 0% contamination using existing methodologies is not guaranteed. Yet researchers disagree on what level of contamination really is detectable, especially in highly processed food products such as vegetable oils or breakfast cereals where the vegetables used to make these products have been pooled from many different sources. A 1% threshold may already be below current levels of detectability.

Finally, who is to be responsible for educating the public about GM food labels and how costly will that education be? Food labels must be designed to clearly convey accurate information about the product in simple language that everyone can understand. This may be the greatest challenge faced be a new food labeling policy: how to educate and inform the public without damaging the public trust and causing alarm or fear of GM food products.

In January 2000, an international trade agreement for labeling GM foods was established. More than 130 countries, including the US, the world's largest producer of GM foods, signed the agreement. The policy states that exporters must be required to label all GM foods and that importing countries have the right to judge for themselves the potential risks and reject GM foods, if they so choose. This new agreement may spur the U.S. government to resolve the domestic food labeling dilemma more rapidly.

India's Top 10 Biotech companies

The top 10 biotech companies in india are:
1.Serum Institute of India
2.Biocon
3.Panacea Biotech
4.Monsanto Biotech
5.Rasi Seeds
6.Venkateshwara Hatcheries
7.Novo Nordisk
8.Tulip
9.Indian Immunologicals
10.TransAsia



Courtesy: BioSpectrum Magazine, www.biospectrum.ciol.com

WORLD'S TOP 10 BIOTECH COMPANIES

The Top 10 Biotechnology Companies

1.Amgen
2.Genentech
3.Serono
4.Biogen Idec
5.UCB-Celltech
6.Genzyme
7.Gilead
8.MedImmune
9.Chiron
10.Millennium


courtesy: BUSINESS INSIGHTS